Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:2/26/2015)... MENLO PARK, Calif. , Feb. 26, 2015 /PRNewswire/ ... has released the latest version of the Governance ... organizations accomplish governance, risk and compliance (GRC) tasks across ... has also been updated to help customers better align ... Organizations of the Treadway Commission ) requirements. In response ...
(Date:2/26/2015)... 26, 2015 On behalf of biotech ... companies, Wilentz, Goldman & Spitzer, P.A. (Wilentz) ... lawsuit against Genewiz Inc. in excess of $10 million. ... GenScript’s trade secrets, and that it improperly hired one ... an order denying motions for judgment notwithstanding the verdict, ...
(Date:2/26/2015)... 26, 2015 BioEnterprise today announced that ... more than $2 billion in growth funding during the ... investors, strategic sources, state – including the Ohio Third ... $2 billion has been raised in the past five ... heels of the BioEnterprise Midwest Healthcare Growth Capital ...
(Date:2/26/2015)... February 26, 2015 Innovation is ... emerging from unexpected parts of the world and ... From agriculture to manufacturing to health care, disruption ... environmental realities and socio-political trends shake the foundations ... key ingredient for CEOs to survive the next ...
Breaking Biology Technology:Protiviti Governance Portal Helps Companies Drive Governance, Risk and Compliance Productivity Across Multiple Business Units 2Protiviti Governance Portal Helps Companies Drive Governance, Risk and Compliance Productivity Across Multiple Business Units 3Wilentz Client GenScript Awarded $10 Million in Trade Secrets Case Against Genewiz 2Wilentz Client GenScript Awarded $10 Million in Trade Secrets Case Against Genewiz 3More Than $2 Billion Invested in Northeast Ohio Bioscience Start-Up Companies Since 2002 2More Than $2 Billion Invested in Northeast Ohio Bioscience Start-Up Companies Since 2002 3More Than $2 Billion Invested in Northeast Ohio Bioscience Start-Up Companies Since 2002 4One Million Acts of Innovation Canada Creates Partnership with The Economist Events’ Innovation Forum 2
... of Energy,s Lawrence Berkeley National Laboratory and the ... world,s first all-integrated sensor circuit based on nanowire ... different crystalline materials. Their method can be used ... , Nanostructures made with specific chemical, electronic, ...
... Revenues - a record $35.5 million vs. $24.7 million in Q2 2007 ... - an increase of 43.4%, Q2 2008 Diluted Net Income per Share - ... ... Q2 2007 Q2 2008 New Bookings of $49.0 million vs. $34.5 million in Q2 2007, ...
... Conference, August 3-8, CHICAGO, Aug. 4 Criminal ... to reduce the spread of the virus.,Instead, it increases ... burdening women and other vulnerable groups who,are unable to ... violence,according to a commentary in the August issue of ...
Cached Biology Technology:A first in integrated nanowire sensor circuitry 2A first in integrated nanowire sensor circuitry 3A first in integrated nanowire sensor circuitry 4eResearchTechnology Reports Second Quarter 2008 Results 2eResearchTechnology Reports Second Quarter 2008 Results 3eResearchTechnology Reports Second Quarter 2008 Results 4eResearchTechnology Reports Second Quarter 2008 Results 5eResearchTechnology Reports Second Quarter 2008 Results 6eResearchTechnology Reports Second Quarter 2008 Results 7eResearchTechnology Reports Second Quarter 2008 Results 8eResearchTechnology Reports Second Quarter 2008 Results 9JAMA Commentary Opposes Criminal Punishment for HIV Exposure/Transmission 2JAMA Commentary Opposes Criminal Punishment for HIV Exposure/Transmission 3
(Date:2/5/2015)... Calif. , Jan. 27, 2015 /PRNewswire/ ... provider of globally deployed, innovative test solutions ... announced the delivery of its TS-323 ... Space Systems Company (LMSSC). GENASYS is a ... demands of mission-critical applications that require performance ...
(Date:2/5/2015)... MOUNTAIN VIEW, Calif. , Feb. 3, 2015 ... screen printer technology, demand from industries such as ... the global market for surface mount technology (SMT) ... manual equipment to automatic control will push the ... glue dispensers will remain steady as glue dispensers ...
(Date:1/22/2015)... 2015 Technology Showcase, Hall E -   EyeLock Inc. ... announced it will showcase its EyeLock ID technology integrated in ... of Energy,s Oak Ridge National Laboratory (ORNL) at ... iris identity authentication technology is being used to validate the ...
Breaking Biology News(10 mins):Marvin Test Solutions' GENASYS Platform Advances Mission-Critical Aerospace Production Test 2Marvin Test Solutions' GENASYS Platform Advances Mission-Critical Aerospace Production Test 3Marvin Test Solutions' GENASYS Platform Advances Mission-Critical Aerospace Production Test 4End-user Demand Spurs Global SMT Screen Printers and Glue Dispensers Market 2End-user Demand Spurs Global SMT Screen Printers and Glue Dispensers Market 3EyeLock Debuts First Iris Authentication Technology Embedded in 3D Printed Automobile 2EyeLock Debuts First Iris Authentication Technology Embedded in 3D Printed Automobile 3
... prevention is worth a pound of cure" can easily ... Because taking off extra weight is an almost insurmountable ... especially childhood, is crucial to realizing optimal long-term health. ... being breastfed might predispose a person to being lean, ...
... The putative skull of Saint Bridget (Birgitta) of Sweden ... is probably not authentic. A new study conducted at Uppsala ... Saint Bridget and her daughter Catherine (Katarina), is not from ... not from the time period when Bridget and Catherine lived. ...
... research of Dr. Doris Taylor was achieved recently when ... agreement with Miromatrix Medical Inc. Dr. Taylor,s research ... that it had created a beating animal heart in ... the promise of one day enabling the replacement of ...
Cached Biology News:Later introduction of baby foods related to lower risk of obesity later in life 2The putative skull of St. Bridget can be questioned 2U of Minnesota finalizes license agreement to form start-up company based on Doris Taylor research 2