Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:12/19/2014)... --Research and Markets ( http://www.researchandmarkets.com/research/fhh9rj/technology ) ... Innovations in Smart Fabrics (Technical Insights)" report ... http://photos.prnewswire.com/prnh/20130307/600769 The Research Service titled ... assessment on technological advancements and market for Smart ... 1. The Smart Fabrics market is expected to ...
(Date:12/19/2014)... 2014 Reports from CDC ... suffer from one or more chronic health conditions - ... can address some of these diseases, but may not ... sufferers face. While implanted nerve stimulation devices today offer ... nerve, which can induce side effects. , To ...
(Date:12/19/2014)...  Decision Resources Group finds that the ... moderately through 2023 as the aging population, increasing adoption ... biomaterials all spur procedure volumes. Growth will be particularly ... and India , where ... for a larger proportion of the population. ...
(Date:12/17/2014)... Based on the revenues gained from surgical ... dominated by four major players contributing to approximately ... include GE Healthcare (U.K.), Siemens AG (Germany), Philips ... Report Copy at http://www.marketsandmarkets.com/Market-Reports/surgical-imaging-market-210534462.html , The ... to its strong product portfolio, which includes its ...
Breaking Biology Technology:Technology Innovations in Smart Fabrics (Technical Insights) 2Draper Wins GSK Funding for Smaller, Smarter Implantable Devices 2Asia Pacific Dental Biomaterial Market Will Grow Strongly Through 2023 2Asia Pacific Dental Biomaterial Market Will Grow Strongly Through 2023 3Global Refurbished Surgical Imaging Market by Product & Application is Estimated to Reach $1.25 Billion by 2019 - New Research Report by MarketsandMarkets 2Global Refurbished Surgical Imaging Market by Product & Application is Estimated to Reach $1.25 Billion by 2019 - New Research Report by MarketsandMarkets 3Global Refurbished Surgical Imaging Market by Product & Application is Estimated to Reach $1.25 Billion by 2019 - New Research Report by MarketsandMarkets 4
... PHILADELPHIA, May 28 Premier Research Group plc ... of Anthony Faragasso, MD as Executive Director and ... position, Dr. Faragasso will lead,the global Medical Management ... and safety services, Dr. Faragasso brings to ...
... ... Manufacturing Experience -, SAN DIEGO, May 28 ... Gordon H.,Busenbark to the company,s board of directors. Mr. Busenbark ... privately,held development-stage specialty pharmaceuticals company focused on,diseases of the central ...
... launch of a new collaborative website initially focusing on ... WikiProfessional technology underlying the site has been developed based ... open access journal Genome Biology, WikiProteins provides a method ... The article is written by Barend Mons of the ...
Cached Biology Technology:Premier Research Names Anthony Faragasso, MD as Executive Director and Global Head of Medical Management and Safety 2Nventa Appoints Gordon H. Busenbark to Board of Directors 2Large-scale community protein annotation -- WikiProteins 2
(Date:12/3/2014)... , Dec. 2, 2014   Marvin ... deployed, innovative test solutions for military, aerospace, and ... version of its successful TS-900 PXI semiconductor ... and features of high-end systems to customers at ... value compared to traditional ATE. ...
(Date:11/21/2014)... Strict laws against distracted driving and the ... American and European automotive sector towards gesture recognition technologies. ... that are intuitive and able to retrieve information with ... New analysis from Frost & Sullivan,s Strategic ... Europe and North America ...
(Date:11/18/2014)... , Nov. 17, 2014   ... and EMC collaborate to develop The Partners Data ... , The Partners Data Lake will allow researcher ... improve diagnostics, treatment and the lives of patients ... research and clinical activities across the Partners system, ...
Breaking Biology News(10 mins):Marvin Test Solutions Brings New Capabilities to PXI-Based Semiconductor Test with TS-960 2Marvin Test Solutions Brings New Capabilities to PXI-Based Semiconductor Test with TS-960 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 2Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 4Partners HealthCare and EMC Unite to Solve Health Care's Toughest Challenges Using Big Data 2Partners HealthCare and EMC Unite to Solve Health Care's Toughest Challenges Using Big Data 3Partners HealthCare and EMC Unite to Solve Health Care's Toughest Challenges Using Big Data 4Partners HealthCare and EMC Unite to Solve Health Care's Toughest Challenges Using Big Data 5
... Mentor Award of the American Association for the Advancement ... education and research changes at his institution, leading to ... biological sciences." Tsin, who is a professor of ... Training in the Sciences at the University of Texas ...
... of Philadelphia (CHOP) have developed a unique laboratory ... molecules. The test relies on faster, more comprehensive ... (HLAs)--complex, highly variable proteins on cell surfaces that ... test may improve transplantation outcomes through a more ...
... , NEW YORK, NY (February 12, 2014) A ... by Wellington V. Cardoso, MD, PhD, has found the ... A deficiency and postnatal airway hyperresponsiveness, a hallmark of ... deficit of this essential vitamin while the lung is ...
Cached Biology News:2013 AAAS Lifetime Mentor Award goes to Andrew Tsin of the University of Texas at San Antonio 2CHOP introduces HLA typing by next-generation sequencing to its clinical services 2CHOP introduces HLA typing by next-generation sequencing to its clinical services 3Prenatal vitamin A deficiency tied to postnatal asthma 2Prenatal vitamin A deficiency tied to postnatal asthma 3
...
Anti 4-hydroxy-2-hexenal (4-HHE) Monoclonal Antibody (HNEJ-2)...
... immunostaining ,This solution has effect on enhancing ... clearer signal than the one obtained by ... of secondary antibody used and exposure time ... have images with high S/N ratio and ...
Anti-human VEGFR-2/KDR (Protein-A Purified) Polyclonal Antibody...
Biology Products: