Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:8/31/2015)... , Aug. 31, 2015 Research and ... the "Middle East & Africa Biomedical Sensors Market ... their offering. The Middle ... estimated at $0.84 billion by 2018 at a CAGR ... near future will bring Biomedical sensors that are adaptable ...
(Date:8/31/2015)... SHANGHAI , Aug. 31, 2015  MicuRx ... antibiotics, today announced positive top-line results from the ... drug candidate MRX-I. MRX-I is an oral oxazolidinone ... MRSA and VRE, while offering physicians and patients ... currently available oxazolidinone agents. "These ...
(Date:8/31/2015)... Tampa, FL (PRWEB) , ... August 31, 2015 ... ... will bring together the world's most successful food and beverage processors, equipment manufacturers ... its competencies in product inspection and industrial weighing and formulation for manufacturers of ...
(Date:8/28/2015)... -- According to a new market research ... Thawing Equipment, Alarms), by Biospecimen (Human Tissue, Stem Cells, ... - Global Forecast to 2020", published by MarketsandMarkets, the ... Million by 2020 from USD 2,150.48 Million in 2015, ... 2020. Browse 74 Tables and 95 ...
Breaking Biology Technology:Middle East & Africa Biomedical Sensors Market Report 2015 - Growth, Trends & Forecasts to 2020 2MicuRX Reports Positive Top-Line Results In Phase 2 Clinical Trial For Novel Antibiotic MRX-I In Complicated Skin And Soft Tissue Infections 2METTLER TOLEDO Hosts Food Safety Educational Center at 2015 PROCESS EXPO 2Biopreservation Market Worth 3,731.03 Million USD by 2020 2Biopreservation Market Worth 3,731.03 Million USD by 2020 3Biopreservation Market Worth 3,731.03 Million USD by 2020 4Biopreservation Market Worth 3,731.03 Million USD by 2020 5
... WORCESTER, Mass. and TORONTO, Sept. 15, 2011 ... today provided an update on the status of ... Antigen Express, Inc. ( www.antigenexpress.com ). ... detailed and comprehensive review of several transaction opportunities, ...
... Calif., Sept. 14, 2011 Sangamo BioSciences, Inc. (Nasdaq: ... Sangamo,s president and CEO, will provide an overview of ... Wednesday, September 21, 2011 at the UBS 2011 Global ... York City. In addition, Geoffrey Nichol, M.B., ...
... Biologics, Inc. announced that it has reached the midpoint ... trial of its Z-Lig™ Anterior Cruciate Ligament Reconstruction (ACLR) ... knee. The randomized multicenter study commenced in January 2011 ... and performance data in the reconstruction of patients, knees ...
Cached Biology Technology:Generex Provides Update on Spinout of Antigen Express 2Generex Provides Update on Spinout of Antigen Express 3Generex Provides Update on Spinout of Antigen Express 4Sangamo BioSciences Announces Presentation at the 2011 UBS Global Life Sciences Conference 2Aperion Biologics Reaches Midpoint of Enrollment in Z-Lig™ Anterior Cruciate Ligament Reconstruction Medical Device Performance Trial 2
(Date:8/6/2015)... BOSTON and TELTOW, Germany ... the 2015 Siggraph Conference, SensoMotoric Instruments (SMI) ... augmented reality , based on Epson,s Moverio ... eye tracking platform. With this new solution, unprecedented quality ... multi-modal, hands-free interaction with context-sensitive displays. For the first ...
(Date:8/5/2015)... According to a new market ... Services, Vertical (BFSI, Airport, IT & Telecom, Utilities, Education, ... to 2020", published by MarketsandMarkets, defines and segments the ... segments. The global PIAM Market is estimated to grow ... 2019, at a CAGR of 14.9 % from 2014 ...
(Date:8/5/2015)... Calif. , Aug. 5, 2015 The ... continuous growth in applications, penetration into newer sectors, and ... year. The global biosensors space has seen the entry ... the market so far. (Photo - ... & Sullivan, Analysis of the Global Biosensors Market ...
Breaking Biology News(10 mins):SMI Shows First Eye Tracking Upgrade for Augmented Reality Glasses 2SMI Shows First Eye Tracking Upgrade for Augmented Reality Glasses 3Physical Identity and Access Management Market Worth $546.2 Million by 2019 2Physical Identity and Access Management Market Worth $546.2 Million by 2019 3Physical Identity and Access Management Market Worth $546.2 Million by 2019 4Innovative Biosensors Incite Use in Non-Traditional Applications 2Innovative Biosensors Incite Use in Non-Traditional Applications 3Innovative Biosensors Incite Use in Non-Traditional Applications 4
... are many and so are some of the things you might ... safe? Is it endangered? While there are many services and rankings ... a group of researchers have found a simple rule of ... likely to be healthy to eat too," said Leah Gerber, an ...
... scientists have decoded for the first time the "stability blueprint" ... which parts of the enzyme are important for its shape ... 14 in Structure and on July 15 in ... development of drugs to treat malaria and other parasitic diseases. ...
... Ill. (August 1, 2012) New research from ... intake in the third trimester of pregnancy may reduce ... stress-related diseases like high blood pressure and diabetes later ... of the Journal of the Federation of American ...
Cached Biology News:Study finds healthy seafood comes from sustainable fish 2Is it a rock, or is it Jell-O? Defining the architecture of rhomboid enzymes 2A diet high in choline during pregnancy may mean less stress for baby 2A diet high in choline during pregnancy may mean less stress for baby 3
...
A component of the Acridinium protein labeling kit....
... real-time PCR detection system holds 48 x 0.2 ... of 48 LEDs independently excites fluorescence (470-500 nm) ... photodiodes detects emitted light (523-543 nm and 540-700 ... Mini cycler, whose Peltier heat pumps provide superb ...
... up to 6 strain chambers with precise uniaxial ... design ensures that cells grow over long periods ... This unit allows you to control the frequency ... unique strain settings. The instrument fits in a ...
Biology Products: