Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:10/30/2014)... James Sherley says he has been working towards ... since his days as a principal investigator at the Fox ... Sherley founded the ASCTC as a new Boston biotech ... property developed in Sherley’s research over the years since FCCC, ... (MIT), and more recently as a senior scientist at the ...
(Date:10/30/2014)... , Oct. 30, 2014 Isis Pharmaceuticals, Inc. (NASDAQ: ... announced that management will present a company overview at the ... a.m. ET in Boston, MA. ... on the "Investors & Media" section of the Company,s website, ... Isis website within 48 hours and will be archived for ...
(Date:10/27/2014)... (PRWEB) October 27, 2014 Ryan Carfley ... this month to sit down with Bryan Hamilton, the publisher ... Solutions to discuss talent in the Research Triangle region of ... that were highlighted at the roundtable include the role ... the significance of work/life balance and the unique role that ...
(Date:10/27/2014)... The “Molecular Diagnostic Market by ... INAAT, DNA Sequencing), End User (Hospital, Laboratories), & ... Forecast to 2018” provides a detailed overview of ... trends, and strategies impacting the global molecular diagnostics ... the revenue and share analysis. , The global ...
Breaking Biology Technology:Boston’s Adult Stem Cell Technology Center, LLC Introduces A New Technology for Monitoring Previously Elusive Adult Stem Cells 2Boston’s Adult Stem Cell Technology Center, LLC Introduces A New Technology for Monitoring Previously Elusive Adult Stem Cells 3Boston’s Adult Stem Cell Technology Center, LLC Introduces A New Technology for Monitoring Previously Elusive Adult Stem Cells 4Isis Pharmaceuticals to Present at the Nomura Biotechnology Conference 2Personify's Ryan Carfley Talks Recruiting with Triangle Business Journal, RPG Solutions 2Personify's Ryan Carfley Talks Recruiting with Triangle Business Journal, RPG Solutions 3Global Molecular Diagnostics Market Will Reach $7.9 Billion by 2018 - New Research Report by MarketsandMarkets 2Global Molecular Diagnostics Market Will Reach $7.9 Billion by 2018 - New Research Report by MarketsandMarkets 3Global Molecular Diagnostics Market Will Reach $7.9 Billion by 2018 - New Research Report by MarketsandMarkets 4Global Molecular Diagnostics Market Will Reach $7.9 Billion by 2018 - New Research Report by MarketsandMarkets 5
... NEW YORK, March 9, 2011 Reportlinker.com announces ... in its catalogue: World Market ... and What,s Not, The ... predictions made about the molecular diagnostics but to ...
... 2011 SPX Corporation (NYSE: SPW ) ... B.W. Murdoch Ltd, a leading engineering company supplying processing ... is based in Auckland, New Zealand. Terms of the ... has decades of experience in the New Zealand dairy, ...
... 2011 AccessClosure, Inc., the U.S. market segment ... from the first published study* (Journal of NeuroInterventional ... different vascular closure devices (VCD) as the primary ... the discomfort associated with the Mynx 5F Vascular ...
Cached Biology Technology:Reportlinker Adds World Market for Molecular Diagnostics: Potential and Reality, What's Hot and What's Not , The 2Reportlinker Adds World Market for Molecular Diagnostics: Potential and Reality, What's Hot and What's Not , The 3SPX Announces Acquisition of B.W. Murdoch Ltd, Broadening Process Engineering and Project Management Capabilities in New Zealand and the Asia Pacific Region 2Significant Reduction in Pain With the Mynx Vascular Closure Device Versus Angio-Seal Device 2Significant Reduction in Pain With the Mynx Vascular Closure Device Versus Angio-Seal Device 3
(Date:10/28/2014)... of the tragic realities of cancer is that ... toxic and their effectiveness varies unpredictably from patient ... poised to change this reality by rapidly assessing ... an individual,s cancer before chemotherapy begins. , A ... by Assistant Professor Melissa Skala has developed the ...
(Date:10/28/2014)... announced awards to expand the Office of Rare ... Advancing Translational Sciences (ORDR-NCATS) collaborative Rare Diseases Clinical ... scientists at 22 consortia will work with 98 ... investigate new treatments for patients with rare diseases. ... in fiscal 2014 funding from NIH. , Rett ...
(Date:10/28/2014)... be building a hybrid micro-grid which will integrate ... in the region, the hybrid micro-grid will test ... diesel, storage and power-to-gas technologies, and ensure these ... built under the new Renewable Energy Integration Demonstrator- ... located offshore at Semakau Landfill and is expected ...
Breaking Biology News(10 mins):Improving breast cancer chemo by testing patient's tumors in a dish 2Improving breast cancer chemo by testing patient's tumors in a dish 3NIH's ORDR-NCATS RDCRN & NICHD awards U54 cooperative agreement for natural history study 2NIH's ORDR-NCATS RDCRN & NICHD awards U54 cooperative agreement for natural history study 3NTU to build region's first renewable energy integration demonstration micro-grid 2NTU to build region's first renewable energy integration demonstration micro-grid 3
... all the genetic sequences in living organisms, has leaned ... the blueprint, unfortunately, has been unintelligible, with no good ... link genomic features to cell function. , A national ... non-profit research center, and Pacific Northwest National Laboratory (PNNL), ...
... Medicine have identified a link between a critical cancer ... be expressed in a number of EBV-associated cancers. Their ... human B cells from the immune system into cancerous ... , Erle S. Robertson, PhD, Associate Professor of Microbiology ...
... target in their fight against a dangerous bacterium that ... implants such as catheters, artificial joints and heart valves. ... epidermidis has, for the first time, been shown to ... that would otherwise kill the bacteria, according to scientists ...
Cached Biology News:Fleshing out the genome 2Defensins neutralize anthrax toxin 2Substance protects resilient staph bacteria 2
Concentration: 1mg/ml. Antigen: Propidium Iodide ...
Anti-Mouse Qa.m7, Ascites (Clone 5035-50.1) (mouse IgM)...
Barcoded Slides, 5 Packs of 5 Slides (25/Case)...
Anti-Mouse Qa.m8, Ascites (Clone 5035-24.1) (mouse IgG3)...
Biology Products: