Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:11/21/2014)... 2014 Deep Research Report on Global ... and in-depth research report on the Sodium ferrocyanide ... its definition, classification, application, and industry chain structure ... the international market analysis, including China’s domestic market ... Europe, Asia, China, Japan etc. regions) industry analysis ...
(Date:11/21/2014)... SAN DIEGO , Nov. 20, 2014  Cytori Therapeutics ... Marc Hedrick , M.D. will present live at VirtualInvestorConferences.com ... 4, 2014 TIME:    11:15 am PT / 2:15 ... this URL into your browser,s address bar: http://bit.ly/1B2KGaL ... time and receive event updates. This will ...
(Date:11/18/2014)... LA (PRWEB) November 17, 2014 ... build-to-order, open architecture blade-based and rackmount computing infrastructure, ... Tesla® K80 dual-GPU accelerator throughout its GPU-enabled blade ... pair of the company’s latest proprietary 80-lane Gen3 ... eight discrete NVIDIA Tesla K80 dual-GPU accelerator cards ...
(Date:11/18/2014)... American Process Inc. (Atlanta, GA) and ... with researchers at Georgia Institute of Technology, Clark ... USDA’s Forest Products Laboratory to develop ultra-strong, lightweight ... a rapidly emerging high performance nanomaterial extracted from ... replace heavy steel structures within cars, such as ...
Breaking Biology Technology:Sodium Ferrocyanide Market: Analysis for Global & China Regions Development Trends Available at DeepResearchReports.com 2Sodium Ferrocyanide Market: Analysis for Global & China Regions Development Trends Available at DeepResearchReports.com 3Cytori Therapeutics to Provide Corporate Update and Investor Presentation on December 4 through a Live, Interactive Webcast 2Cytori Therapeutics to Provide Corporate Update and Investor Presentation on December 4 through a Live, Interactive Webcast 3Cytori Therapeutics to Provide Corporate Update and Investor Presentation on December 4 through a Live, Interactive Webcast 4Cirrascale® Expands Multi-GPU Peering Solutions with Support for New NVIDIA Tesla K80 Dual-GPU Accelerators 2Cirrascale® Expands Multi-GPU Peering Solutions with Support for New NVIDIA Tesla K80 Dual-GPU Accelerators 3American Process Inc. Announces Partnership to Develop Ultra-Strong, Lightweight Automotive Components Using Nanotechnology from Nature 2American Process Inc. Announces Partnership to Develop Ultra-Strong, Lightweight Automotive Components Using Nanotechnology from Nature 3
... Blacksburg, Va. Researchers at the Virginia Bioinformatics Institute ... guidelines that should help researchers in their efforts to ... The stakes are high: the concept of biological parts ... engineering are to be applied to biology. If successful, ...
... Mass., Aug. 8 Pressure,BioSciences, Inc. (Nasdaq: PBIO ... to discuss its second quarter 2008 financial results and,to ... the,teleconference either by telephone or through a live web-cast. ... Date: Thursday, August 14, 2008, Time: 4:30 p.m. ...
... Aug. 8 MGT Capital Investments,Inc. (Amex: ... the Healthcare,Information Technology ("HCIT") sector, today reported financial ... and provided an update on,strategic milestones., Tim ... through,the first half of 2008 reflect continued progress ...
Cached Biology Technology:Tips on how to build a better home for biological parts 2Tips on how to build a better home for biological parts 3Pressure BioSciences, Inc. to Discuss Second Quarter 2008 Financial Results and Provide Business Update 2MGT Capital Investments Reports Second Quarter 2008 Financial Results and Provides Update on Recent Developments 2MGT Capital Investments Reports Second Quarter 2008 Financial Results and Provides Update on Recent Developments 3MGT Capital Investments Reports Second Quarter 2008 Financial Results and Provides Update on Recent Developments 4MGT Capital Investments Reports Second Quarter 2008 Financial Results and Provides Update on Recent Developments 5
(Date:11/18/2014)... 2014 The Parenteral Drug Association (PDA) today confirmed ... speak and at least seven more will participate in the ... Shoreham Hotel in Washington D.C. , Dec. ... significant support from the regulatory agencies in the ... in our effort to help advance the use of metrics ...
(Date:11/11/2014)... Inc., a Chicago -based digital forensics ... of Yaniv Schiff from Senior Computer Forensics ... role as Director, he will lead company efforts to ... provide leadership within the company,s digital forensics practice area.  ... Schiff joined Forensicon in 2006 and has ...
(Date:11/7/2014)... Leading Biometric companies aim to provide ... online transactions.  Companies in focus today are: NXT-ID, Inc. (NASDAQ: ... BABA ), Google Inc. (NASDAQ: GOOG ), Microsoft ... EBAY ) and MasterCard Inc. (NYSE: MA) ... biometric authentication company focused on the growing mobile commerce is ...
Breaking Biology News(10 mins):FDA's Janet Woodcock, EMA's Emer Cooke Headline PDA Quality Metrics Conference 2Yaniv Schiff Promoted to Director of Digital Forensics at Forensicon, Inc. 2Universal Authentication Methods Provide More Secure Operations for Biometrics Devices - Company Joins FIDO Alliance for Consumer Protection 2Universal Authentication Methods Provide More Secure Operations for Biometrics Devices - Company Joins FIDO Alliance for Consumer Protection 3Universal Authentication Methods Provide More Secure Operations for Biometrics Devices - Company Joins FIDO Alliance for Consumer Protection 4Universal Authentication Methods Provide More Secure Operations for Biometrics Devices - Company Joins FIDO Alliance for Consumer Protection 5Universal Authentication Methods Provide More Secure Operations for Biometrics Devices - Company Joins FIDO Alliance for Consumer Protection 6
... de Barcelona (UAB) has discovered the first scientific evidence of ... ancient Scythian warriors living over 2,000 years ago in the ... now, the results published in PLoS ONE indicate ... of Europeans, but to a demographic expansion of local Central ...
... wild pandas may need new dinner reservations and quickly ... off swaths of bamboo that pandas need to survive. ... , scientists from Michigan State University and the Chinese Academy ... affect the most common species of bamboo that carpet the ...
... Nobody knows the remarkable properties of human skin like ... our skin sensitive, sending the brain precise information about ... preserve a protective barrier against the world. Combining these ... exciting challenge for Stanford Chemical Engineering Professor Zhenan Bao ...
Cached Biology News:Mongolia and the Altai Mountains: Origins of genetic blending between Europeans and Asians 2Mongolia and the Altai Mountains: Origins of genetic blending between Europeans and Asians 3Climate change threatens giant pandas' bamboo buffet and survival 2Touch-sensitive plastic skin heals itself 2Touch-sensitive plastic skin heals itself 3
... 48 lanes, 24 bi-directional, of patient DNA ... either slab gel or capillary sequencers, using ... parameters in Explorer have been sealed to ... have built Explorer for ease of use, ...
Molecular Biological Resources offers bulk quantities of existing protein products. Please see the Chimerx divisions website for existing products and contact lloconne@molbiores.com for pricing....
... Quality ISO 9001:2000 Certified USDA Research ... Validated, SOP's Training AALAS Certified ... All Procedures GLP Documentation Upon Request ... shopping point for all your custom immunology ...
... BalanceTalk XL provides balance data collection and ... Complete integration with Microsoft Excel , ... moisture analyzers , New balances can be added ... Collect data from multiple balances into one spreadsheet ...
Biology Products: