Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:4/17/2015)... MIAMI (PRWEB) April 17, 2015 ... attend the GTCbio Stem Cell Summit 2015 April 27 ... present the latest developments in all areas of stem ... business of stem cells and regenerative medicine. , ... clinical trials, as well as translational research in stem ...
(Date:4/16/2015)... Bythewood, South Carolina (PRWEB) April 17, 2015 ... solutions and steam system services, released their newly ... 2015. The customer facing website effectively promotes ... proposition. , All the information that a ... training, steam system services, company capabilities, industries serviced, ...
(Date:4/16/2015)... South San Francisco, CA (PRWEB) April 16, 2015 ... it is scheduled to report first quarter results on ... Following the announcement, Cytokinetics’ senior management will host a ... operational and financial results and the company’s outlook for ... webcast and can be accessed from the homepage and ...
(Date:4/16/2015)... Associates IRB, Inc., the industry-leading central IRB in customer ... Laboratory Drive in the heart of Research ... house review board and service staff, which will be ... service to clients. CBRE | ... while Capital Associates Management, LLC represented the landlord.   ...
Breaking Biology Technology:Global Stem Cells Group To Join GTCbio Stem Cell and Regenerative Medicine Summit in Boston, April 27-29, 2015 2Global Stem Cells Group To Join GTCbio Stem Cell and Regenerative Medicine Summit in Boston, April 27-29, 2015 3Spirax Sarco website has a new look 2Cytokinetics to Announce First Quarter Results on April 30, 2015 2Cytokinetics to Announce First Quarter Results on April 30, 2015 3Schulman IRB to Open Office in Research Triangle Park, N.C. 2
... YORK , Feb. 10 Intellect ... company focused on development of disease-modifying therapeutic agents for ... significant shareholders (the "Interested Shareholders") have agreed in principle ... the Company in its efforts to restructure its balance ...
... YORK , Feb. 10 DuPont (NYSE: ... he expects the DuPont Agriculture & Nutrition segment to grow sales ... across the seed, crop protection, and nutrition and health businesses.   ... is paying off," Borel said at the Goldman Sachs 14th Annual ...
... Additional AeroLEF patents granted in Europe , China ... Feb. 10 /PRNewswire-FirstCall/ - YM BioSciences Inc. (NYSE ... additional patents in the US for AeroLEF(R), the Company,s proprietary, ... the treatment of moderate to severe acute pain. US patent ...
Cached Biology Technology:Intellect Neurosciences, Inc. Announces Preliminary Agreement with Significant Shareholders to Provide Interim Funding and Assist the Company in Efforts to Secure Additional Financing 2Intellect Neurosciences, Inc. Announces Preliminary Agreement with Significant Shareholders to Provide Interim Funding and Assist the Company in Efforts to Secure Additional Financing 3Intellect Neurosciences, Inc. Announces Preliminary Agreement with Significant Shareholders to Provide Interim Funding and Assist the Company in Efforts to Secure Additional Financing 4DuPont Expects Strong 2010 Agriculture & Nutrition Sales Growth, Margin Expansion 2DuPont Expects Strong 2010 Agriculture & Nutrition Sales Growth, Margin Expansion 3DuPont Expects Strong 2010 Agriculture & Nutrition Sales Growth, Margin Expansion 4DuPont Expects Strong 2010 Agriculture & Nutrition Sales Growth, Margin Expansion 5YM BioSciences granted two US patents for AeroLEF(R) 2YM BioSciences granted two US patents for AeroLEF(R) 3YM BioSciences granted two US patents for AeroLEF(R) 4
(Date:4/1/2015)... 2015  NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" ... the growing mobile commerce market, announces the second shipment ... underway to early access pre-order customers. ... retail outlets including Walmart, Target, AT&T, Dunkin, Donuts, Stop ... accepted at all outlets and very easy to use. ...
(Date:3/31/2015)... , March 31, 2015  Elephant Talk Communications ... a global provider of Software Defined Network Architecture (ET ... announced total revenue of approximately $20.4 million for the ... restated $19.5 million for the year ended December 31, ... 2014, the Company had completed its multi-year transition away ...
(Date:3/30/2015)... --Research and Markets ( http://www.researchandmarkets.com/research/lc9bnl/global_gesture ) has ... Market in Automotive Sector 2014-2018" report to their ... Recognition market in Automotive Sector to grow at a ... Gesture recognition is the ability of a device to ... Gesture recognition technology can be 2D-based or 3D-based. It ...
Breaking Biology News(10 mins):NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 2NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 3NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 4Elephant Talk Reports 2014 Fourth Quarter and Year End Financial Results 2Elephant Talk Reports 2014 Fourth Quarter and Year End Financial Results 3Elephant Talk Reports 2014 Fourth Quarter and Year End Financial Results 4Elephant Talk Reports 2014 Fourth Quarter and Year End Financial Results 5Elephant Talk Reports 2014 Fourth Quarter and Year End Financial Results 6Global Gesture Recognition Market in Automotive Sector Report 2015 - Growing Number of Partnerships 2
... Society (ACS) Weekly PressPac from the Office of ... peer-reviewed journals and Chemical & Engineering News ... American Chemical Society as the source for this ... ARTICLE #1 FOR IMMEDIATE RELEASE Advance ...
... and civilian personnel from the U.S. Armed Forces, as ... enforcement and other first-responder personnel from throughout the United ... and attend the 2009 Force Protection Equipment Demonstration (FPED ... Airport and Marine Corps Base, Quantico, VA, during May ...
... Durham, N.C., and Chapel Hill, N.C. -- Researchers at Duke ... discovered in mice how a single disrupted gene can cause ... In a study published in the journal ... is needed so that neurons in the brain can ...
Cached Biology News:American Chemical Society's weekly PressPac -- May 6, 2009 2American Chemical Society's weekly PressPac -- May 6, 2009 3American Chemical Society's weekly PressPac -- May 6, 2009 4American Chemical Society's weekly PressPac -- May 6, 2009 5American Chemical Society's weekly PressPac -- May 6, 2009 6Demonstration Features Commercial Technology for Combating Terrorism 2Preclinical work shows how one gene causes severe mental retardation 2Preclinical work shows how one gene causes severe mental retardation 3
Request Info...
Prepared in distilled water....
... egg white. The extinction coefficient , E(1%) ... mM phosphate-buffered saline, pH 7.4, ... and 50% glycerol. Avidin (from egg white) is ... by molecular sieving and is ...
NM522 contains an F episome, which is required for production of ssDNA and for blue/white color selection. To maintain the F, NM522 should be grown on minimal (M-9) medium....
Biology Products: