Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:1/23/2015)... BioPharma Inc. (NASDAQ: ARRY ) today announced ... Pharma AG to acquire worldwide rights to encorafenib (LGX818), ... agreement is conditional on the closing of transactions announced by ... are expected to close in the first half of ...
(Date:1/22/2015)... , Jan. 22, 2015  Transwestern | RBJ today announces ... of office space for Shire a leading biopharmaceutical company, at ... Transwestern | RBJ,s Robert Richards , president, and ... lease for the entire five-floor building at 95 Hayden Ave. ...
(Date:1/22/2015)... The laboratory information management systems market is a ... technological advancements due to factors such as rising pressure ... healthcare systems, and increasing government support for adoption of ... players in the market focus on technological advancements to ...
(Date:1/22/2015)... 2015 zFlo Motion , a US ... an exciting product from a new partner. STT-Systems ... the past 15 years, with offerings in the optical-motion capture, ... IMU system (inertial measurement unit), iSen, is opening eyes around ...
Breaking Biology Technology:Array Announces Agreement To Acquire ENCORAFENIB (LGX818) 2Array Announces Agreement To Acquire ENCORAFENIB (LGX818) 3Array Announces Agreement To Acquire ENCORAFENIB (LGX818) 4Array Announces Agreement To Acquire ENCORAFENIB (LGX818) 5Array Announces Agreement To Acquire ENCORAFENIB (LGX818) 6Array Announces Agreement To Acquire ENCORAFENIB (LGX818) 7Transwestern | RBJ Advises Shire in 202,000 SF Lease, Creating Boston's Largest Suburban Biotech Campus 2Laboratory Information Management Systems Market is Expected to Reach $1,323.6 Million by 2019 - New Research Report by MarketsandMarkets 2Laboratory Information Management Systems Market is Expected to Reach $1,323.6 Million by 2019 - New Research Report by MarketsandMarkets 3Laboratory Information Management Systems Market is Expected to Reach $1,323.6 Million by 2019 - New Research Report by MarketsandMarkets 43D Motion Capture Just Got Easy 2
... with today,s invisibility cloaks, people can,t walk through walls. ... The electrons perform this trick, called macroscopic quantum tunneling, ... of space that is normally off-limits under the laws ... of electrons collectively move through a superconducting nanowire, they ...
... Scientists from the Georgia Institute of Technology have ... "confinement controlled sublimation" technique for growing high-quality layers ... technique relies on controlling the vapor pressure of ... fabricating the material. The basic principle for ...
... 2011 MaxWest Environmental Systems, Inc. ... wastewater treatment industry, was recognized on stage yesterday at ... Meeting in New York City for its Commitment to ... selected as an exemplary approach to addressing challenges in ...
Cached Biology Technology:Scientists observe how superconducting nanowires lose resistance-free state 2Scientists observe how superconducting nanowires lose resistance-free state 3Controlling silicon evaporation allows scientists to boost graphene quality 2Controlling silicon evaporation allows scientists to boost graphene quality 3MaxWest Environmental Systems Makes Commitment to Clinton Global Initiative 2MaxWest Environmental Systems Makes Commitment to Clinton Global Initiative 3
(Date:1/22/2015)...  Analyst Report Issued by Small Cap IR. In 2011, Nilson ... transactions at merchants on the leading payment cards rose to ... debit, and prepaid cards reached 6.54 billion.  Eight million credit ... usage in 2012, and credit and debit card fraud resulted ...
(Date:1/22/2015)... Infinisource has launched its new NXG series of time clocks ... a higher standard for collecting attendance and labor data and ... installation, touch screen interface and seamless connection to cloud-based iSolved, ... solution for the small to mid-size employer. The ...
(Date:12/22/2014)... , Dec. 22, 2014  The 2014 Holiday Season may ... Acuity Market Intelligence reports that the long anticipated floodgates ... that intensifying demand for smart phones, tablets, and wearable ... market of 2.5 billion users with nearly 4.8 billion ...
Breaking Biology News(10 mins):$4.80 Near Term Price Target with "Buy" given by CapRock Research for NXT-ID, Inc. (NASDAQ: NXTD) issued by Small Cap IR 2Infinisource's NXG series sets new time clock standard 2First Season of Holiday Shopping with Mobile Biometric Payments Wraps Up With a Present for Biometrics Industry: A Rosy Forecast for More Than 2 Billion Users of 4.8 Billion Mobile Biometric Devices by 2020 2
... developed a computer modeling method to accurately predict how ... the complex work from an inhibitory weeks-long process to ... efficient evaluation of a nerve,s response to millions of ... accurate and capable electrodes to stimulate nerves and thereby ...
... MD, a clinician and scientific investigator in the Division ... Beth Israel Deaconess Medical Center (BIDMC) has been selected ... the Doris Duke Charitable Foundation. The three-year award, which ... and environmental factors that lead to kidney disease in ...
... its first appearance in Texas, a prehistoric crocodile thought to ... native of the Lone Star State. The switch in ... the identification of a well-preserved, narrow fossil snout that was ... The 96-million-year-old fossil from Texas is the oldest prehistoric crocodile ...
Cached Biology News:Fast prediction of axon behavior 2BIDMC scientist David J. Friedman, M.D., receives award from Doris Duke Charitable Foundation 296-million-year-old fossil suggests prehistoric crocodile Terminonaris was Texas native 296-million-year-old fossil suggests prehistoric crocodile Terminonaris was Texas native 396-million-year-old fossil suggests prehistoric crocodile Terminonaris was Texas native 4
EDTA, tetrasodium salt, 1 kg. Ethylene diaminetetraacetic acid.Dihydrate. Assay: 99-101% (as is).Risks: 36, 37, 38 ; Safety Precautions: 22, 36, 37. Category: Nucleotides & Enzymes & Biochemicals, Ul...
EDG-1 Western blot control Source: Cell Lysate Application: Western Blotting Control...
...
Kit containing positive control DNA all parts of the HIV-1 genome, HIV-1 negative control DNA, Primers SK38, SK39, SK19...
Biology Products: