Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:5/28/2015)... CARLOS, Calif. , May 28, 2015 /PRNewswire/ ... testing, today announced a study published in ... the Panorama single-nucleotide polymorphism (SNP)-based non-invasive prenatal test ... the first trimester. A study ... that complete molar pregnancies occur in about 1 ...
(Date:5/28/2015)... BEACH, Fla. , May 28, 2015 ... supporting the anti-cancer potential of its growth hormone-releasing hormone ... at the 2015 ASCO Annual Meeting. The data ... target for Biscayne,s anti-cancer GHRH blockers, is present on ... status. These findings suggest that GHRH antagonists could have ...
(Date:5/28/2015)... Whitehouse Laboratories is excited to announce that ... with PTI Inspection Systems. Whitehouse Labs and PTI will ... method development and validation programs using the most ... includes a more formal program that facilitates cross training ... enables a more effective team approach, especially as it ...
(Date:5/28/2015)... 2015 Clinerion, an eClinical ... and the Alliance for Clinical Research Excellence ... organization operating in the public interest and ... enhance quality, safety, integrity and operational effectiveness ... are pleased to announce their partnership for ...
Breaking Biology Technology:First Confirmed Detection of a Complete Molar Pregnancy with Cell-Free DNA Test 2First Confirmed Detection of a Complete Molar Pregnancy with Cell-Free DNA Test 3Data Presented At 2015 ASCO Annual Meeting Shows Biscayne Pharmaceuticals' GHRH Antagonist Target Is Expressed Across All Breast Cancer Subtypes 2Data Presented At 2015 ASCO Annual Meeting Shows Biscayne Pharmaceuticals' GHRH Antagonist Target Is Expressed Across All Breast Cancer Subtypes 3Whitehouse Labs Renews & Enhances Partnership with PTI Inspection Systems 2Whitehouse Labs Renews & Enhances Partnership with PTI Inspection Systems 3Clinerion and ACRES Partner on Patient Recruitment and Risk-Based Quality Management 2Clinerion and ACRES Partner on Patient Recruitment and Risk-Based Quality Management 3
... by Launch of Nine Emerging Therapies, Including Five Oral Agents, According ... ... Resources, WALTHAM, Mass., May 29 Decision Resources, one of the,world,s ... highly anticipated launch of the first,oral agents formally approved for multiple sclerosis ...
... Inc. (Nasdaq: MAPP ) today announced the appointment ... Vice President of Human,Resources., Mr. Rosa brings over ... recently, Mr. Rosa worked at Carl Zeiss Meditec, Inc. ... had held since May of,2002. He was an integral ...
... Incorporated,(Nasdaq: GPRO ) announced today that the Company ... specific molecular diagnostic test to detect,high-risk strains of the ... Assay has been CE marked and is currently available,for ... marking and launch of our APTIMA HPV Assay in ...
Cached Biology Technology:Oral Drug From Novartis/Mitsubishi Tanabe Will Capture the Largest Market Share of All Emerging Multiple Sclerosis Therapies in 2017 2MAP Pharmaceuticals Appoints Marco Rosa Vice President of Human Resources 2Gen-Probe Launches in Europe CE-Marked APTIMA(R) HPV Assay for Detection of Human Papillomavirus 2Gen-Probe Launches in Europe CE-Marked APTIMA(R) HPV Assay for Detection of Human Papillomavirus 3Gen-Probe Launches in Europe CE-Marked APTIMA(R) HPV Assay for Detection of Human Papillomavirus 4Gen-Probe Launches in Europe CE-Marked APTIMA(R) HPV Assay for Detection of Human Papillomavirus 5
(Date:5/18/2015)... May 18, 2015 Fingerprint Cards (FPC) ... FPC1025, FPC1145, FPC1155 and FPC1035 from one if its module ... and including Q3 2015 and the sensors will be used ... order values for 2015 hereby amount to 740 MSEK to ... of 140 MSEK and a number of smaller orders not ...
(Date:5/11/2015)... 2015 Curemark LLC, a privately held drug ... new Phase III double blind, randomized, placebo-controlled clinical trial ... on all children ages 3-8 with Autism. Previously, Curemark ... double blinded clinical trial for CM-AT in children ages ... digestive enzyme chymotrypsin. This new trial will help determine ...
(Date:5/5/2015)... -- NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" or the ... commerce market, reminds investors and media that  Mr. David ... CARTES SECURE CONNEXIONS AMERICA 2015, held in Washington ... three-day conference is organized into a series of nine session ... Global Fraud: Where is the Trust in Cyberspace? and ...
Breaking Biology News(10 mins):Fingerprint Cards Receives Touch Fingerprint Sensor Order of SEK 230 Million and Raises Revenue Guidance for 2015 2Curemark, LLC, Launches New Phase III Trial in Expanded Population of Children with Autism 2NXT-ID, Inc.'s CTO, David Tunnell, Presents at CARTES SECURE CONNEXIONS AMERICA 2015 Today in Washington DC. 2NXT-ID, Inc.'s CTO, David Tunnell, Presents at CARTES SECURE CONNEXIONS AMERICA 2015 Today in Washington DC. 3
... plants to treat their offspring for disease, research by biologists ... 6 in the journal Ecology Letters. "We ... plants, can reduce parasite infection in the monarchs," says Jaap ... "And we have also found that infected female butterflies prefer ...
... at the Gladstone Institute of Virology and Immunology (GIVI) have ... in the liver is required for the infectious activity of ... new strategy for treating the infection. More than 160 ... is available to prevent further spread of the disease. Current ...
... at the Georgia Institute of Technology and Emory University have ... material into the body to improve the treatment of inflammatory ... become a popular research area because of its potential therapeutic ... a living organism has been an obstacle. In the ...
Cached Biology News:Study finds monarch butterflies use medicinal plants to treat offspring for disease 2Gladstone scientists link hepatitis C virus infection to fat enzyme in liver cells 2Researchers develop oral delivery system to treat inflammatory bowel diseases 2Researchers develop oral delivery system to treat inflammatory bowel diseases 3
For mRNA Differential Display with three one-base anchored oligo-dT primers and rationally designed arbitrary 13mers. These kits feature the latest generation of isotopic mRNA Differential Display t...
Request Info...
... Panomer 9 oligodeoxynucleotides are ... labeled at the 5' ... Alexa Fluor dyes and ... assessing microarray spot morphology, ...
Topoisomerase I, isolated from wheat germ, is an enzyme capable of removing negative supercoils from covalently closed circular DNA (1)....
Biology Products: