Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:10/20/2014)... Earle Martin , Chief ... that Ellen Teplitzky, an experienced attorney specializing in ... industry, has joined the firm as Director of ... practice. NDA Partners provides legal services, including ... to top law firms and their clients in ...
(Date:10/19/2014)... 2014 NextCODE Health, which enables clinicians and researchers ... time, today announced the launch of its new genomic data ... the American Society of Human Genetics (ASHG) annual meeting in ... up and apply for free beta access, visit www.nextcode.com ... can be viewed here . The Exchange: ...
(Date:10/19/2014)... (PRWEB) October 19, 2014 The report ... Market Share, Trade, Prices, Geography Trend and Forecast (2011 ... sales category, and geography and studies the major market ... North America, Europe, and Asia. , The global chocolate ... 2010.to $98.3 billion in 2016 at an estimated CAGR ...
(Date:10/18/2014)... 19, 2014 The “Human Insulin ... Intermediate Acting, Premixed), Modern Human Insulin (Rapid Acting, ... NovoRapid, Novomix, Tresiba, Others) - Forecast to 2018” ... restraints, challenges, opportunities, current market trends, and strategies ... the estimates and forecasts of the revenue and ...
Breaking Biology Technology:NDA Partners Appoints Ellen Teplitzky, JD as Director of its Legal Services Practice 2The NextCODE Exchange: The first global, real-time system for sharing full-resolution genomic data 2The NextCODE Exchange: The first global, real-time system for sharing full-resolution genomic data 3Chocolate Market Projected To Reach $98.3 Billion by 2016 - New Report by MarketsandMarkets 2Chocolate Market Projected To Reach $98.3 Billion by 2016 - New Report by MarketsandMarkets 3Chocolate Market Projected To Reach $98.3 Billion by 2016 - New Report by MarketsandMarkets 4Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 2Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 3Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 4Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 5
... A Market with High Potential as Diagnostics become Centre ... MedicineKUALA LUMPUR, Malaysia, March 23 While the in-vitro ... the Big Three: US, Europe and Japan, which constitute ... such as India, Brazil and China are expected ...
... aftereffects of a chlorine gas disaster in a South Carolina ... expect and how to prepare emergency response systems for an ... study is now available in the January 2009 issue of ... "This is one of the largest community exposures to chlorine ...
... Ltd. announced today that data recently published from Harvard-CDC ... discoveries by Dr. Samuel and Elenore Bogoch of peptides ... Replikins, which are shared across flu strains, conserved over ... 1957 and 1968, as well as current H5N1 outbreaks, ...
Cached Biology Technology:Frost & Sullivan: In Vitro Diagnostics Market 2Frost & Sullivan: In Vitro Diagnostics Market 3New study examines effects of Graniteville, S.C., chlorine gas disaster 2New study examines effects of Graniteville, S.C., chlorine gas disaster 3Confirmation of Bogoch Replikins Influenza Patents by Harvard-CDC and Scripps-Crucell Data 2
(Date:10/15/2014)... The book ,Models of Life, is a non-traditional biophysics ... itself. The book is a journey of discovery into ... of life and biological regulation. It is about how ... strategic communication between the billions of cells in an ... the relationships between principles, which can be found on ...
(Date:10/15/2014)... be awarded the 44th Rosenstiel Award for Distinguished Work ... research exploring the mechanisms of genomic instability and its ... is the second alumnus to win the Rosenstiel Award; ... 2003. , Alt is the Charles A. Janeway Professor ... School and an investigator at the Howard Hughes Medical ...
(Date:10/14/2014)... N.Y. – Scientists have sequenced the house fly genome ... one might expect from an insect that thrives in ... published Oct. 14 in the journal Genome Biology ... biology and of how flies quickly adapt to resist ... Adult house flies (Musca domestica) carry and transmit more ...
Breaking Biology News(10 mins):New book about life as seen from physics 2Brandeis awards 44th Rosenstiel Award to pioneering geneticist Fred Alt 2House fly genome reveals expanded immune system 2
... and scientist, who has spent the best part of the ... AIDS throughout the world, is calling for global strategies and ... , Quinn, a professor of infectious diseases at Hopkins and ... Infectious Disease, reports that women have in the last 20 ...
... fruit flies to people, naturally produce disease-fighting chemicals, ... a counter move, some disease-causing bacteria have evolved ... antimicrobial peptides as a warning signal. This alarm ... avoid destruction. , University of Washington (UW) and ...
... the three-dimensional terrain of a synapse -- the junction ... brain and nervous system. The "nano-map," which shows the ... one-billionth of a meter, has already proven its worth ... Using the map as a guide, the research team, ...
Cached Biology News:AIDS expert says global strategy needed to combat feminization of HIV/AIDS 2AIDS expert says global strategy needed to combat feminization of HIV/AIDS 3Bacteria recognize antimicrobials, respond with counter-defenses 2The synapse is a shotgun 2The synapse is a shotgun 3
Best pricing for 100mg-1.0g scales. Phosphopeptides are our specialty....
... The ProteomeLab PF 2D is an automated, ... complex protein mixtures. Part of Beckman ... 2D produces results in just hours. ... proteins present in cell lysates, addressing a ...
... Library Panels were designed for full-length gene ... PCRs to identify the desired cDNA clone. ... a 96-well "Master Plate," where each well ... identified the positive well(s) by gel electrophoresis ...
... Jobin Yvons Protein 295 ex can measure ... sample in only a few minutes. To ... acids tyrosine and tryptophan, the Protein 295 ... a pulsed diode emitting 295 nm. Fluorescence ...
Biology Products: