Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:10/25/2014)... 24, 2014 According to new ... Data Center Types (Colocation, Enterprise, Telecom), by Design ... 1, Tier 2, Tier 3, Tier 4) - ... and segments the Data Center Construction Market into ... of revenues. This research report also identifies the ...
(Date:10/25/2014)... Addison, TX (PRWEB) October 24, 2014 ... skincare products, announced the winners of its “Reflect Your ... who have not only seen a difference in their ... also experienced a new outlook on life as a ... Youth” contest originated as an effort by Nerium International ...
(Date:10/25/2014)... Oramed Pharmaceuticals Inc. (NASDAQCM: ORMP) ( http://www.oramed.com ... of oral drug delivery systems, announced today that the ... FireRock Capital,s Micro-Cap Conference. Presentation Details: ... 28, 2014 ,Time: 9:15am EST ,Location: The Spring Mills ... , About The FireRock Conference  ...
(Date:10/25/2014)... Research and Markets has announced ... , Research Area & by End User - Global ... In this report, the global epigenetics market ... and end users. The product segments of the epigenetics ... consumables, kits, and reagents. The subsegments of the enzymes ...
Breaking Biology Technology:Data Center Construction Market Worth $22.73 Billion by 2019 - New Report by MarketsandMarkets 2Data Center Construction Market Worth $22.73 Billion by 2019 - New Report by MarketsandMarkets 3Data Center Construction Market Worth $22.73 Billion by 2019 - New Report by MarketsandMarkets 4Nerium International™ Inspires Conversation About the Journey of Aging with “Reflect Your Youth” Contest 2Oramed to Present at the FireRock Annual Micro-Cap Conference 2Oramed to Present at the FireRock Annual Micro-Cap Conference 3Global Epigenetics (VLA, WBA, NBA, RTA, Rotary-Wing Aircraft) Market - Forecast to 2019 2Global Epigenetics (VLA, WBA, NBA, RTA, Rotary-Wing Aircraft) Market - Forecast to 2019 3
... This week Jonathan Watson will become the first student to ... engineering dual degree program . , ,Watson, a native of ... UW-Eau Claire and his bachelors degree in engineering from the ... great advantage in preparing for engineering course work because I ...
... and PowerPoint slides online is not enough, faculty and staff ... audio to liven up their course Web pages thanks to ... grant. , ,The services web site, Streaming Media at ... the production of streaming video and audio, comparisons of different ...
... has a new home: Health Sciences Learning Center ... health sciences on the UW-Madison campus. , ,Part of this ... DeLuca , associate dean for research and graduate studies at ... nursing, pharmacy and physical therapy students in one facility. DeLuca ...
Cached Biology Technology:Student to graduate in the Dual Degree Physics and Engineering Program 2University of Wisconsin enriches course web sites with streaming media 2UW Medical School to build Health Sciences Learning Center 2
(Date:10/17/2014)... in German . ... day in order to reproduce? And why are there two ... the latest issue of the research journal Molecular Human ... Steven Ramm from Bielefeld University Bielefeld has compiled this special ... for a female to copulate with several males in quick ...
(Date:10/17/2014)... in German . ... drugs. When treating overdoses, doctors are often limited to supportive ... there is a combination of drugs involved. So what can ... his grandmother,s pills? ETH professor Jean-Christophe Leroux from the Institute ... answer to this question. "The task was to develop an ...
(Date:10/16/2014)... of Marine Science have received a 3-year, $392,773 ... the streams and wetlands most vulnerable to sea-level ... governments and citizens conserve these important ecosystems. , ... tidal-marsh observations first gathered by VIMS scientists in ... today,s researchers accurately map the slow but inexorable ...
Breaking Biology News(10 mins):Sperm wars 2Emergency aid for overdoses 2Emergency aid for overdoses 3EPA grant will help localities conserve headwater wetlands 2EPA grant will help localities conserve headwater wetlands 3
... one of the less common types of skin cancer but it ... percent). The five-year survival rate for early stage melanoma is ... cancer is detected late or there is recurrence. So a ... the goal is to remove as little tissue as possible while ...
... University of Maryland, in partnership with the University of ... received a $7.9 million federal grant to acquire a ... will help researchers unravel the mysteries of molecules and ... diseases. The grant is among the largest of ...
... Instructor in Medicine, University of Washington, and Associate, Human ... been chosen by the American Society for Microbiology (ASM) ... her outstanding work elucidating the role of neutralizing antibodies ... Health Division, this award recognizes an early career scientist ...
Cached Biology News:Seeing melanoma 2Seeing melanoma 3University of Maryland partnership receives $7.9M from NIH for superconducting research magnet 2University of Maryland partnership receives $7.9M from NIH for superconducting research magnet 3
3T3 cells (RSV-transformed) Source: Cell Lysate Form: Ready to Use Application: Western Blotting Control...
Madin-Darby bovine kidney (MDBK) cells Source: Cell Lysate Form: Ready to Use Application: Western Blotting Control...
A431 cells stimulated with EGF Source: Cell Lysate Form: Ready to Use Application: Western Blotting Control...
Peptide-affinity Purified Polyclonal Antibody to Olfactory Receptor, Family 2, Subfamily H, Member 3...
Biology Products: