Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:7/30/2015)... ... July 30, 2015 , ... Tronics, a designer ... & Marketing Director. , With more than 25 years of experience in ... Tronics’ business development activities worldwide. He brings to the company his strong expertise ...
(Date:7/30/2015)... ... July 30, 2015 , ... Leading regenerative veterinary medicine ... its canine osteoarthritis stem cell product, currently under development for FDA approval. The ... be marketed in the US by Aratana. This product, termed AT-016, is an ...
(Date:7/30/2015)... across the globe, ISN improves the efficiency and effectiveness of contractor management systems. ISN,s ... reliable contractors in over 80 countries. ... ... Over 60,000 Worldwide Customers In More Than 80 Countries ... Headquartered in Dallas, TX , ISN has additional offices in Calgary ...
(Date:7/30/2015)... WARRINGTON, Pa. , July 30, 2015 /PRNewswire/ ... announced that it has received the second $1.0M ... Business Innovation Research (SBIR) grant valued at up ... the company,s aerosolized KL4 surfactant as a potential ... lung injury.  Discovery Labs was awarded an initial ...
Breaking Biology Technology:Tronics appoints Francois Vieillard as Sales and Marketing Director 2VetStem Biopharma Successfully Completes Large Milestone Efficacy Study for its Flagship Canine Osteoarthritis Stem Cell Product 2VetStem Biopharma Successfully Completes Large Milestone Efficacy Study for its Flagship Canine Osteoarthritis Stem Cell Product 3ISN Reaches Over 60,000 Worldwide Customers 2ISN Reaches Over 60,000 Worldwide Customers 3Discovery Labs Receives $1.0 million under an SBIR Grant in Continuing Support of the Development of Aerosolized KL4 Surfactant to Address Radiation-Induced Lung Injury 2Discovery Labs Receives $1.0 million under an SBIR Grant in Continuing Support of the Development of Aerosolized KL4 Surfactant to Address Radiation-Induced Lung Injury 3
... - Attendees at The 18th ... Stimulus Plan Era , The ... use of,the billions allotted for healthcare information technology transformation ... the "Stimulus,Package," according to observations shared at the 18th ...
... Finesse Solutions, LLC, Santa Clara, CA, a manufacturer ... applications, announced the technical demonstration of TruFluor(TM) pH, a ... New York on March 17, 2009.The TruFluor pH and ... disposable sheath, an optical reader, and a transmitter. The ...
... Cell Therapeutics, Inc. (CTI) (Nasdaq and MTA: CTIC) ... The NASDAQ Stock Market indicating that the NASDAQ Listing ... the Company,s common stock on The NASDAQ Capital Market, ... 6, 2009, the Company demonstrate compliance with all applicable ...
Cached Biology Technology:Experts at Healthcare Conference Support Investments in the Health of Work Culture and Care Processes, Not Just Technology 2Experts at Healthcare Conference Support Investments in the Health of Work Culture and Care Processes, Not Just Technology 3Experts at Healthcare Conference Support Investments in the Health of Work Culture and Care Processes, Not Just Technology 4Finesse Demonstrates TruFluor(TM) pH, a Single-Use Optical pH Sensor and Transmitter 2Cell Therapeutics Announces Receipt of NASDAQ Listing Update 2Cell Therapeutics Announces Receipt of NASDAQ Listing Update 3
(Date:7/7/2015)... -- Research and Markets ( ... "Capacitive Fingerprint Sensors Patent Landscape" report ... fingerprint sensing technology is the most reliable and ... developed. This patent landscape focuses on fingerprint sensors ... of capacitive fingerprint sensors is closely linked to ...
(Date:7/7/2015)... , July 7, 2015 NXT-ID, Inc. (NASDAQ: ... on the growing mobile commerce market announces a revised version of ... week. The commercial will air on CNBC in New ... Angeles and San Francisco metro ... commercial focuses on Wocket,s ability to replace all the cards in ...
(Date:7/2/2015)... DUBLIN , June 25, 2015 ... the addition of the "Next Generation Biometrics Market ... to 2020" report to their offering. ... $24.4 Billion by 2020, at a CAGR of 17.9% ... is the leading application for the market. Safran ...
Breaking Biology News(10 mins):Worldwide Capacitive Fingerprint Sensors Patent Landscape Market Report 2015-2020 - Main IP Holders include Seiko Epson, AuthenTec, Sony and STMicroelectronics 2Wocket Smart Wallet Commercials Airing on CNBC to Showcase This Summer's Must- Have Tech Product 2Wocket Smart Wallet Commercials Airing on CNBC to Showcase This Summer's Must- Have Tech Product 3Next Generation Biometrics Market 2015 - Global Forecast to 2020 with Safran, NEC, 3M Cogent, Fujitsu & Suprema Dominating the $24 Billion Market 2Next Generation Biometrics Market 2015 - Global Forecast to 2020 with Safran, NEC, 3M Cogent, Fujitsu & Suprema Dominating the $24 Billion Market 3
... more intense rainstorms and more frequent heat waves are ... when climate change is mentioned. Now, two University of ... transmission in wild birds can be added to the ... used a mathematical model to explore the consequences of ...
... of beetles and only two species of the tuatara, a ... Zealand. Crocodiles and alligators, while nearly 250 million years old, ... "winners" including mammals and many species of birds and ... biology. Scientists have often posited that because ...
... marine whelk, Solenosteira macrospira . He does all the work ... few of the baby snails are his own. The surprising ... S. macrospira in a small club of ... and sibling cannibalism, and the species has one of the most ...
Cached Biology News:Climate change could increase levels of avian influenza in wild birds 2Climate change could increase levels of avian influenza in wild birds 3Why are there so many species of beetles and so few crocodiles? 2Why are there so many species of beetles and so few crocodiles? 3Male snails babysit for other dads 2Male snails babysit for other dads 3
Recombinant Viral CCI/Fc Chimera, CF...
... Guinea Pig serum is collected from fasted Guinea ... Citrate N-04: Heparin (Na) ... N-10: EDTA (Na) N-03: ... CPD N-09: K3EDTA N-11: ...
GENOMIPHI V2 DNA AMP KIT 25RXN, 1 EA. Category: Genomics DNA Amplification....
EPH electrode, anode, 1. Category: Electrophoresis Systems & Standards & Reagents, IEF & SDS-PAGE & 2-D Electrophoresis, Multiphor II Kits & Components and Accessories....
Biology Products: