Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:9/18/2014)... Research and Markets has ... Industry Report 2014" report to their offering. ... 2014 is a professional and in-depth study on ... The report provides a basic overview ... industry chain structure. The N-acetylcysteine market analysis is ...
(Date:9/18/2014)... 2014 Research and Markets has ... (Polymerase Chain Reaction, In-situ hybridization, Immunohistochemistry) Market - Trends ... The global companion diagnostics market is ... 2014 to 2019. Factors such as rising need for ... diagnostics by the pharmaceutical industry, support from regulatory authorities, ...
(Date:9/18/2014)... ST. LOUIS , Sept. 18, 2014  U.S. ... portfolio by signing an exclusive license for technology developed ... to control gene expression in plants, including for applications ... species. The technology was developed under ... science officer at Kultevat and former president of the ...
(Date:9/18/2014)... 2014  Neogen Corporation (Nasdaq: NEOG ) ... agreement with Merck Animal Health to market Neogen,s Igenity ... Igenity Dairy Heifer Program consists of genomic tests that ... potential of replacement dairy heifers. The genomic tests can ... is an excellent tool in the decision-making process for ...
Breaking Biology Technology:Global N-acetylcysteine Industry Report 2014 2Global Companion Diagnostics (Polymerase Chain Reaction, In-situ hybridization, Immunohistochemistry) Market - Trends & Forecasts to 2019 2Global Companion Diagnostics (Polymerase Chain Reaction, In-situ hybridization, Immunohistochemistry) Market - Trends & Forecasts to 2019 3Kultevat obtains license of gene switch technology 2Merck Animal Health to market Neogen's dairy genomic program 2
... woundcare division of,Insense Ltd., today announced it has received ... Oxyzyme product in the treatment of,difficult and chronic wounds. ... one of the world,s leading wound care specialists, in ... The announcement was made at,the 3rd Congress of the ...
... June 6 Inverness Medical,Innovations, Inc. (Amex: IMA ... for the consumer and professional markets, today,announced that it ... & Medical Technology Conference being held June 11-12, 2008,at ... Jon Russell, Vice President,Finance, will present on Thursday, June ...
... June 6 DURECT Corporation,(Nasdaq: DRRX ) announced today that ... New York, NY., -- Needham & Company,s ... June 12th at 11:30 a.m. EDT. -- Leerink Swann,s Pain ... 12:45 p.m. EDT. -- Jefferies, 2nd Annual Healthcare Conference on ...
Cached Biology Technology:Revolutionary Healing Technology for Treating Difficult and Chronic Wounds Approved by Health Canada 2
(Date:9/19/2014)... biology professor will study multifunctional and specialized spinal ... a National Science Foundation grant in the amount ... Berkowitz, professor in the Department of Biology, OU ... the differences between the multifunctional and specialized spinal ... use and what connections they make. Berkowitz ...
(Date:9/19/2014)... are a species which over thousands of years has adapted ... a substance that makes the cold dangerous for you. , ... albidus , and the cold provoking substance, called nonylphenol, comes ... Nonylphenol is suspected of being a endocrine disruptor, but when ... the worm,s ability to protect the cells in its body ...
(Date:9/19/2014)... regulate their symbiotic relationship with soil bacteria by ... plant structure from leaves into the roots to ... roots. This collaborative study was conducted by researchers ... Graduate University for Advanced Studies (SOKENDAI), and the ... , Legumes, an important plant family which ...
Breaking Biology News(10 mins):Environmental pollutants make worms susceptible to cold 2Environmental pollutants make worms susceptible to cold 3For legume plants, a new route from shoot to root 2
... are known for their almost uncanny ability to detect ... have traced the origin of those electrosensory powers to ... to many head and facial features in humans. , ... the current edition of Evolution & Development, identifies neural ...
... men having a heart attack drove themselves to hospital and only ... the latest Journal of Advanced Nursing. , The study, ... teaching hospitals in Dublin, Southern Ireland, also found that it took ... departments after their symptoms first started. But only one per cent ...
... the University of New Hampshire campus, David Berlinsky, assistant professor ... black sea bass circle slowly in the dim light. The ... College of Life Sciences and Agriculture, and home to Berlinsky's ... menus, but wild populations of the fish are in decline ...
Cached Biology News:UF scientists trace origin of shark's electric sense 2UF scientists trace origin of shark's electric sense 3One in 14 men having a heart attack drive themselves to hospital 2One in 14 men having a heart attack drive themselves to hospital 3Uncovering sex-change secrets of black sea bass 2
HP 1 alpha Immunogen: Synthetic peptide between amino acids 1-100 of the human HP 1 alpha protein. Storage: -20 C, Avoid Freeze/Thaw Cycles...
... subcloning of gene in baculoviral expression ... and plaque purification of ten clones, ... for one clone, protein expression and ... culture. Expected yield and timeline: 1-4 ...
... Custom Synthesis Service provides you ... to knockdown any gene. We ... base pairs with terminal dT ... other lengths of your choice. ...
EDG-1 Western blot control Source: Cell Lysate Application: Western Blotting Control...
Biology Products: