Navigation Links
Cancer siRNA Oligo Set Version 1.0

This comprehensive siRNA discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics research using RNAi.

Cancer-related genes were chosen in collaboration with leading academic cancer researchers (see table below for a list of genes). Every siRNA has been designed using state-of-the-art design criteria to give a high success rate for gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-stranded oligos are purified by HPLC and annealed. The final siRNA product is >97% pure. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB1
YES1 Each Cancer siRNA Oligo Set includes 2 siRNAs to each of 139 cancer genes in addition to a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled controls, all supplied at 1 nmol. Comprehensive information is also included, containing gene list, Genbank accession numbers, and sequences and positions of the siRNA within the sequence.

Examples of siRNA target information Gene
Accession # Unigene Target
siRNA target %GC
NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1
NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4
NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4
NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52



Page: All 1 2 3 4

Related biology technology :

1. Tissue Specificity for Mutation Parallels Tissue Specificity for Cancer
2. Cancer-Related miRNAs Uncovered by the mirVana miRNA Microarray Platform
3. Detection of Mutant K-ras in a Kindred With Hereditary Pancreatic Cancer by DGGE
4. Detection of p53 Gene in Breast Cancer by Denaturing Gradient Gel Electrophoresis and the DCode System
5. Proteomics in Bladder Cancer Research: Protein Profiling of Bladder Squamous Cell Carcinomas, Rev C
6. Genome Wide Profiling of Paired Cancerous and Normal Breast Tissues and Rapid Interpretation of Gene Expression Data
7. Custom and library siRNA for efficient gene silencing
8. Custom and library siRNA for efficient gene silencing
9. Library siRNA
10. Custom siRNA Oligo Synthesis Service
11. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
Post Your Comments:

(Date:3/4/2020)... , ... March 04, 2020 , ... This month, Cognosante ... Orlando, FL. The company will showcase both expanded and emerging offerings that align with ... 2020 is designed to be comprehensive, timely, and engaging. From Interoperability ...
(Date:2/28/2020)... ... February 26, 2020 , ... ... combines a high-speed camera with a dedicated controller, thus simplifying setup, streamlining integration, ... the HS7 is the first of Fastec Imaging’s new HS Series cameras to ...
(Date:2/21/2020)... ... February 20, 2020 , ... The ... and reassuring consumers that what’s listed on an ingredient panel is actually in ... introduced this solution with the adoption of CertainT, which is designed to protect ...
(Date:2/19/2020)... ... 2020 , ... Intech , the leader in contract ... unified global brand identity, as it celebrates its 20th anniversary. , Fueled by ... an enthusiasm for designing and manufacturing state-of-the-art medical devices, Intech has grown leaps ...
Breaking Biology Technology:
(Date:3/4/2020)... HUNTINGTON, N.Y. (PRWEB) , ... March 04, 2020 ... ... natural eye supplements, today announced the release of a unique, multi-dimensional nutraceutical formula ... uses both published science and natural plant biology to increase the retina’s healthy ...
(Date:3/4/2020)... ... March 04, 2020 , ... RoosterBio Inc., a leading ... systems, announces today a significant milestone in the regenerative medicine field with the ... has been treated by RoosterBio’s pharmaceutical customer with an Investigational New Drug (IND) ...
(Date:3/2/2020)... ... March 02, 2020 , ... Toronto-based clinical research organization (CRO) and regulatory consulting ... location just 5 minutes south of Clarksburg on a farm on Beaver Valley Road. ... of the Rainbow Orchard, and decided it would be a great new option for ...
Breaking Biology News(10 mins):